Tables showing the inhibitory absorbances at 420nm for trial 1 and 2.
Second trial of enzyme assay after correctly adding the DMSO inhibitor compounds at 420nm.
First trial of enzyme inhibition after incorrectly adding the DMSO compounds at 420nm.
in
12/6-Enzyme inhibition assay was carried out using the previous sample of Yop-H from the regular enzyme assay.
Enzyme assay conducted with Yop-h and tested at several conditions under 420 nm of ultraviolet light. The concentration containing 45.27 ng/uL will go on to be used for an inhibition assay.
12/3- Enzyme assay carried out on Yop-H.
weeks 17&18
11/24-Protein characterization done.
Fig. 1. SDS-page for trial 1 of Yop-H Tyrosine Phosphatase. Lane 1 contains the Colorplus prestained protein ladder. Lane 2 contains the cell lysate after induction. Lane 3 contains the soluble fraction. Lane 4 contains the flow through. Lane 5 contains the wash. Lane 6 and 7 contain elution 1 and 2 respectively. Was unable to post picture horizontally.
11/23- Protein Purification carried out along with FPLC.
FPLC result showing the elution 1 in 50mM Tris, 150 mM NaCl, and 1 mM DTT.
11/21- Protein expression carried out in the Biobricks on Yop-H.
11/18- Results returned. No positive clone. Group also showed no positive clones and thus will move on to surrogate target. (Yop-H) Threonine Phosphatase.
weeks 15&16
11/13- Cloning was finished and sent to sequencing. The sequence was unable to be read due to some unknown reasoning and thus it appeared as it appeared as so:
11/12- LIC cloning was carried out for the last attempt.
11/7- PNIC-BSA4 was regrown in LB agar for one final round of cloning.
10/31- Results were received showing no positive clones. None of the other group members have created a positive clone yet.
10/29- Ligation Independent cloning was conducted.
10/22- PNIC-BSA4 was regrown for a second round of cloning. This time they were grown for a lesser amount of time. Only -13 hours.
10/21- Sequencing results returned. Again almost all N's in the data.
weeks 13&14
weeks 11 & 12
10/14- Virtual Screening was continued. The positive and negative ligands were added.
Control Ligands - V. cholerae
#
1
glycine
Molecular Weight: 75.0666 [g/mol]
Molecular Formula: C2H5NO2
XLogP3: -3.2
H-Bond Donor: 2
H-Bond Acceptor: 3
2
serine
Molecular Weight: 105.09258 [g/mol]
Molecular Formula: C3H7NO3
XLogP3: -3.1
H-Bond Donor: 3
H-Bond Acceptor: 4
3
theronine
Molecular Weight: 119.11916 [g/mol]
Molecular Formula: C4H9NO3
XLogP3: -2.9
H-Bond Donor: 3
H-Bond Acceptor: 4
4
methionine
Molecular Weight: 149.21134 [g/mol]
Molecular Formula: C5H11NO2S
XLogP3: -1.9
H-Bond Donor: 2
H-Bond Acceptor: 4
5
Calcium ion
Compound ID: 271
Molecular Weight: 40.078 [g/mol]
Molecular Formula: Ca+2
H-Bond Donor: 0
H-Bond Acceptor: 0
6
SO4
Molecular Weight: 96.0626 [g/mol]
Molecular Formula: O4S-2
XLogP3-AA: -1.5
H-Bond Donor: 0
H-Bond Acceptor: 4
7
PO4
Molecular Weight: 94.971362 [g/mol]
Molecular Formula: O4P-3
XLogP3-AA: -2.3
H-Bond Donor: 0
H-Bond Acceptor: 4
8
O-phosho-L-serine
Molecular Weight: 183.056602 [g/mol]
Molecular Formula: C3H6NO6P-2
XLogP3-AA: -4.7
H-Bond Donor: 1
H-Bond Acceptor: 6
9
O-phosho-D-serine
Molecular Weight: 183.056602 [g/mol]
Molecular Formula: C3H6NO6P-2
XLogP3-AA: -4.7
H-Bond Donor: 1
H-Bond Acceptor: 6
10
Fluorine ion
Molecular Weight: 18.998403 [g/mol]
Molecular Formula: F-
XLogP3-AA: 0.6
H-Bond Donor: 0
H-Bond Acceptor: 1
Negative Control Ligands
Aspirin
Molecular Weight: 180.15742 [g/mol]
Molecular Formula: C9H8O4
XLogP3: 1.2
H-Bond Donor: 1
H-Bond Acceptor: 4
cas number: 278-06-8
92.141
C7H8
2.98
0
0
3-hydrazinopropanoic
104.109
C(C[NH2+]N)C(=O)[O-]
-1.83
4
4
cis-2-Fluoro-cyclopropanecarboxylic acid
Molecular Weight: 104.079703 [g/mol]
Molecular Formula: C4H5FO2
XLogP3-AA: 0.3
H-Bond Donor: 1
H-Bond Acceptor: 3
1-azido-3-fluoropropane
103.1
C(CN=[N+]=[N-])CF
1.58
0
3
2-hydroxybutanoic acid
103.097
CC[C@H](C(=O)[O-])O
-0.21
1
3
10/13- Another batch of eluted primers was retried using the same samples in the hopes that something went wrong due to machine error.
pLIc2 forward: NNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNGCNNNNNNNNNNNNNNNNNNNNNNNNANGGNNTTTNNNNN NNNNNNNNNNNNNNNNNANNCNCTCCTGANCANNGANNNNNNNNNNNNNNGNNNGNNNNNNNTNNNNNTNNGNNNNNNNN NAANNNNNNNNNNNNNGNNNNNNGNNNNNNNNNNTTNTNNNNNNNN
10/11- Results from DNA sequencing were returned. The machine could not read the majority of base pairs.
Concentration of sample 2 after being eluted in solution and adding primers. The yield was 26.6 ng/uL at wavelenght of 230nm.
Concentration of sample 6 after adding elution solution and primers. Concentration was 77.8 ng/uL at wavelenght of 230nm.
10/7-Concentrations of samples were determined after pLIC forward and reverse primers were added. (include concentrations here)
Sample 5 provided a yield of 12.5 ng/uL at a wavelenght of 230nm. This sample will not be used for sequencing due to too low of concentration.
Sample 6 showed a yield of approxiamately 40.9 ng/uL at a wavelenght of 230 nm. This sample will be sent to sequencing.
Sample 7 showed a concentration of 8.3 ng/uL at 230nm. This was one will not go on to sequencing due to too low of a yield.
10/4- Miniprep was done using all the samples that produced pellets. (Tubes 2,5,6,7)
Please include pictures of gel images, virtual results, plates, etc, and include analysis too, rather than just listing what you did. -UM weeks 9 & 10
10/31- samples were spun down and stored in the 4 degrees fridge. Only 4 out of the 8 samples produced a pellet. (Forgot to take pics of tubes, sorry)
Master Plate of 8 samples. Only 2,5,6,7 would go on to produce a pellet. The tubes containing the samples may have been left in too long and some colonies taken may have been dead.
10/30-The first two plates had grown many colonies. (in less than 48 hrs.) Plates were moved to 4 degrees fridge after creating a master plate.
Colonies of growth shown after approximately 36 hours of incubation in the 37 degrees incubator. This sample, labeled tube A contained 2uL of T4 treated accepting vector and 4uL of T4 treated insert.
Colonies of growth shown in this sample. This sample labeled B contained 1uL of accepting vector treated with T4 and approxiamately 5uL of T4 treated insert.
10/29-The steps from the previous day were repeated just in case the first round failed to clone.(It was noted that the following day (wed, Oct 30) the second set was missing from the incubator and the first two plates showed no signs of growth.
10/28- Cohesive end generation along with annealing were carried out using cut pNIC-BSA4 plasmid with a concentration of approximately 74.7 ng/uL. The samples were then added to agar plates containing sucrose and kanamycin and stored in the 37 degrees celsius refrigerator.
10/24- Virtual screening and set up of active sites was started. Ligands will be found next. Crystal structure is available in PDB and thus a homology model will not need to be created.
10/23- Today Preparation of PNIC-Bsa4 as an accepting vector was retried.
weeks 7&8
10/17- Cloning of pNIC-Bsa4 was began. After preparation of pNIC-Bsa4 was done, an error was made in that the QF buffer used during PCR cleanup was lacking its normal qualities. This was determined after Nanodrop was carried out and thus this protocol will be continued again.
10/14-10/15:Transformation of pNIC-BSa4 was attempted again after the first yield was considered too small (14.0 and 12.8 ng/uL). This time the yields after midi-Prep were 45.9 and 45.6 ng/uL.
Concentration of insert gene (phsophoserine phosphatase) for cloning with a yield of 45.9 ng/uL at a wavelength of 230nm and after midi-prep.
Concentration of 45.6 ng/uL for trial #2 at an absorbance of 230nm. This yield was taken after midiprep was performed.
10/11- Another flask containing LB media was created again and stored in the fridge.
Midi-prep- 10/8 The first attempt of midi-prep was performed leading up to a concentration of 14 ng/ul and 12 ng/ul. These yields were determined to be too low and transformation will be regrown and attempted again.
Transformation- 10/7-8 Bacteria DH5 alpha was grown with the pNIC-Bsa4 Restriction enzyme.
Image of your secondary PCR from 92613? Need figure captions as well. - Michael T. weeks 5&6
Protein Characterization: 10/3-10/4 pNIC-BSA 4 was grown with DH5-alpha. The first attempt had a yield that was considered overgrown. This will be attempted again.
PCRSQUARED: 10/1/13 This was done using the custom tails. Some contamination could be seen. Next will be PCR cleanup which will be done the following week.
Vcpp PCR Squared in lanes 7-10. The weight of the protein is approximately 100 base pairs. This was done in a 1x agarose gel using a 1kb ladder
Pymol Refreshner: 9/27-9/28
Fig. 1- Hydrophobic structures in red, ions in cyan, and polar structures in orange. The cofactors can be shown as spheres. The NAPs are the top two right blue sphere clusters while the bottom right blue cluster is the DAP. The DU is shown with the yellow and red sphere cluster in the bottom left.
Analysis: The data tells us where the different important molecule chains are. The proteins analyzed include 3HBB, 1U72, 3CL9, and 2H2Q. Cofactors were identified and labeled. However, the most important aspect of this lab was aligning the 3CL9 and 1U72 proteins to see how and if they bind when aligned. Molecules are able to be studied virtually before being worked with in virtual lab to save potential time and money by previewing how different substrates bind to different active sites of molecules. No difficulties were experienced while working with Pymol. However, some possible sources of error include: not following directions, uploading wrong proteins, or forgetting to identify an important chain.
Secondary PCR: 9/26/13 was redone using the custom tails.
*computer program did not let me crop out black areas. Fig. 2. This gel image shows the custom tail primers that were ordered in 1x agarose gel. The number of nucleotides in this image is approximately 1000 b.p. in lenght. Week 3 & 4:
Will - Good work in lab. show your final tail Primer sequences. Include an Analysis after each experiment. Show a ladder image. - Dr. B 092713
LB Broth: 9/19/13 A flask of LB was started and is still being created. It is being held in the -20 degrees C fridge. 16 Agar plates with kanamycin were created by Dax and Julia (group members).
Primary and Secondary PCR: 9/16/13
x1 Agarose Gel containing Primary and Secondary PCR, lane 4 and 5 respectively.
1
Secondary PCR might be redone since option A was used instead of the newly ordered custom primerers.
Tail Primer Design 9/13/13
This was the primers created for future cloning. Here is the sequence: TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGACGCGCTGACCACCCTCCCGATCAAAAAGCACACCGCGCTGCTGAACCGTTTCCCGGAAACCCGCTTCGTTACCCAACTGGCGAAAAAGCGTGCGTCTTGGATCGTTTTCGGTCACTACCTCACTCCAGCACAGTTTGAAGATATGGATTTTTTCACCAATCGTTTCAATGCGATCCTGGACATGTGGAAAGTTGGCCGTTACGAAGTTGCGCTGATGGACGGTGAACTGACCTCTGAACACGAAACCATCCTGAAAGCGCTGGAACTCGACTACGCTCGCATCCAGGACGTTCCAGACCTCACCAAACCGGGCCTGATCGTTCTCGACATGGACTCTACCGCTATCCAGATCGAATGCATCGACGAAATTGCGAAGCTGGCGGGTGTTGGCGAGGAAGTGGCCGAAGTTACGGAACGTGCGATGCAGGGCGAGCTGGACTTCGAACAGTCTCTGCGTCTGCGTGTTTCTAAACTCAAAGACGCCCCTGAACAGATCCTGAGCCAGGTTCGTGAAACGCTGCCGCTCATGCCTGAACTGCCGGAACTGGTTGCGACCCTGCACGCGTTCGGTTGGAAGGTAGCAATCGCGTCTGGTGGTTTCACCTACTTTTCTGACTACCTGAAGGAACAACTCAGCCTCGATTACGCGCAGTCTAACACCCTGGAAATTGTTTCTGGTAAACTGACTGGTCAAGTTCTGGGTGAAGTTGTGTCTGCTCAGACCAAAGCGGACATCCTGCTGACCCTGGCGCAACAGTACGACGTTGAAATCCACAACACCGTTGCGGTGGGTGACGGTGCGAACGACCTGGTTATGATGGCGGCTGCGGGCCTCGGTGTAGCGTACCATGCGAAACCGAAGGTTGAGGCGAAGGCGCAGACCGCAGTTCGTTTCGCTGGTCTCGGTGGTGTCGTTTGCATCCTGTCTGCGGCGCTCGTTGCGCAGCAAAAACTCTCTTGGAAATCTAAACCGTAACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAA TAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT
Restriction Enzyme Digest 9/10/13
Lane 1 contains the DNA ladder. In lane 2, the uncut plasmid is shown with approximately 600-700 b.p. while lane 3 contains plasmid cut with EcoRI (700 b.p.). Lane 4 contains the pGBR-22 cut with PVU-2 (550 b.p.) and lane 5 contains plasmid cut with both EcoRI and PVU-2 (first cut=600 b.p. and second cut=350 b.p.)) This was expressed in 1% agarose gel.
Analysis: The three pieces of cut plasmids showed extensive and defined bands. This gel was also being run with PCR and that is why there is a 2nd ladder in lane 6. Lane 3 showed the first cut at about 1500 bp and 2nd at about 800 b. Lane 4 had 2 cuts at about 600 bp and 200 bp. Lane 5 had 2 distinct bands at 600 base pairs and 200 bp. Some possible sources of error that could have happened would be incorrect calculations and/or measurements. Some other sources of possible errors include pierced gel or incorrect pipetting The bands appeared as expected. The temp. recommended is 80 degrees celsius.
PCR Attempt 3:
PCR expressed in 1x agarose gel. There are distinct bands in lane 4 (sample 3) and a lighter shaded band in lane 4 (sample 2).
PCR Attempt 2: still no bands! (did not take a picture/wasn't sure if we had to).
Week 1 & 2
Will - good. on your next gel image, crop out the black stuff. Can crop directly from gel software. Dr. B 090913 9/2/13-PCR
The gel image after electrophoresis was performed on the sample of pGBR-22. There are no distinct bands on the image.
9/2/13-Oligotide Primer Design The sequence used was found on NCBI and it varied from the one off of the wikispaces page. This protein was designed for use on vibrio cholerae. The exact strain is ICE224. antacgncntanacancanatttanttaagtatnnaanancangagttaatgtaananca ncaaggatagatanancanatagaaggtantgtgganancanatatantagganaaagga aaataanancanagggcaaaanan.
Analysis: A reverse primer was created to help synthesize PCR. This was done using DNA works on the NBCI website. After this, the primer was placed for ordering on the google docs VDS page. Some possible sources of error include inputing the wrong DNA sequence when creating the primer or inputing incorrect info into the ordering page.
Week 1: 8/30/13-Target Selection sent by email
The protein to be studied for targeted is phoshposerine phosphatase.
Gene id: YP_005334106.1
8/30/13- Nanodrop Spectrophotometer: Determining the Concentration of DNA Plasmid
The purpose of this lab was to be able to use a spectrometer to identify the absorption and concentration of pGBR-22. Although practice, this laboratory technique will probably be used in individual research.
Images:
Sample 1: Elution graph showing pGBR-22 (205.4ng/uL) with a concentration of 198.1ng/uL.
Sample 2: Elution graph showing pGBR-22(205.4ng/uL) concentration of 195.3ng/uL.
Results and Conclusions: This experiment gave additional practice with using the photo spectrometer. Both samples had a theoretical concentration of 205.4ng/uL. However, sample 1 had a concentration of 198.1ng/uL while sample 2 had a concentration of 195.3ng/uL. Some possible errors and explanations for these discrepancies could have been that residue from the buffer or water were left on the lens. There could have also been some unrelated particles inside the tubes containing the samples.
8/29/13-Submission of DNA to Sequencing Machines
Purpose: To prep a plasmid for DNA sequencing at an offsite facility.
Images:
Sequencing Results returned from the Processing Facility
Good. Need more analysis. -UM
Week 19
12/6-Enzyme inhibition assay was carried out using the previous sample of Yop-H from the regular enzyme assay.
12/3- Enzyme assay carried out on Yop-H.
weeks 17&18
11/24-Protein characterization done.
11/23- Protein Purification carried out along with FPLC.
11/21- Protein expression carried out in the Biobricks on Yop-H.
11/18- Results returned. No positive clone. Group also showed no positive clones and thus will move on to surrogate target. (Yop-H) Threonine Phosphatase.
weeks 15&16
11/13- Cloning was finished and sent to sequencing. The sequence was unable to be read due to some unknown reasoning and thus it appeared as it appeared as so:
11/12- LIC cloning was carried out for the last attempt.
11/7- PNIC-BSA4 was regrown in LB agar for one final round of cloning.
10/31- Results were received showing no positive clones. None of the other group members have created a positive clone yet.
10/29- Ligation Independent cloning was conducted.
10/22- PNIC-BSA4 was regrown for a second round of cloning. This time they were grown for a lesser amount of time. Only -13 hours.
10/21- Sequencing results returned. Again almost all N's in the data.
weeks 13&14
weeks 11 & 12
10/14- Virtual Screening was continued. The positive and negative ligands were added.
10/13- Another batch of eluted primers was retried using the same samples in the hopes that something went wrong due to machine error.
pLIc2 forward: NNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNGCNNNNNNNNNNNNNNNNNNNNNNNNANGGNNTTTNNNNN
NNNNNNNNNNNNNNNNNANNCNCTCCTGANCANNGANNNNNNNNNNNNNNGNNNGNNNNNNNTNNNNNTNNGNNNNNNNN
NAANNNNNNNNNNNNNGNNNNNNGNNNNNNNNNNTTNTNNNNNNNN
pLIC2 reverse-
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNGNNGNNNNNNNGNNNNNNNNNNNNNNNNCN
NTNNNNNNTNNTANTCTNNNNANNNANGGNNGNGNNNNNNNGNNNNNNNCNNNNNNNCANNNCGTANNNGCGGCNGCTNC
NGCNNNNNNNNNNNNNNNNNNNGNNNGATNNNNGNGGATNGNNTGNNNGNNNNNNANNGTNNNTCNNNNNNNTCNNGNGG
NNNNNNNNNNTNNNNGNAGNNNNNANNNNNGGNNCNNNNAANNNNNNNNNANANNNNNNNNANNNNNNNNANCNNNNNNG
NTNNNNATNNNNNNNNNNNGTNNGNNNNNNNNTNNNCNGTACTNNNNGNNNNNNNNGNNNNTNNAANNANNNNNNCNNTN
AANANNNNNNNNNNNNNNNNNNNNNCNNNNNNNANNNNNCNNCNNNNNNNNNNNGNNNNNNNNNNNANTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNGNCNNANCCNNNNNNCNNNNNNNNNNNNNNNNNANNNNNNNNNNNNN
NNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNCNNNNNNN
NNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATNTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNN
pLIC6 forward-
NNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNTTNNNNNNNNNNNNNNNGGNNNTNNNNNNNNNNNNNNTNNNNNNN
NNNNNNNNNNNNNNNNANNNNNGNNGNNNNGNNNNNNNNNGNCCNNTNNNNNNNNANNANNNGNNNNNNNNNNNTANCNN
GNNNNNNNANNNNTNNNANNNNNNNGNNNNNCNNNGGNNNNNNNNCNNNNNNNNNGNCNNNNNNNNNNNNGGNNNNANNN
NNNNNANNGNNNNNNNNNNNNNNANNNNNNNNNNNCNNNNNNNNNGNNNNNNTTNTNTTNTTTTTTTTNTNTNNTTNNNN
NNTNANNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNGGNCNNNNNNNNNNNNNNGTNNNNNNNGN
NNNNNNNCCNNNNNNNNNNNCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNCCCNNGTN
TNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNNNNNGNNCGNNCNNNNNNNNNNNNTNNNNNNTNNCNNNNNNNNNNNN
NNNNNNNNCNANNNNNNNNNNNNNNNNNNNNNNNNCNCNNNNNNNNNNNCNNNNNNNNNNNANNNANNCNNNNNNNNNNT
NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNCNN
NNNNNNNNNNNNNNNNNNNNNNGANNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
pLIC6 reverse-
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANANNNNTTNNNNNNANNGNTGNGGNNTNNNNNNNGCGCTANANNNN
CNNTNTGNNNTTTNNATTGNNNGANNGACNNANGCNNNGTNCCGNNNNNGCNNCANTNACNNNGNNNAANGACGGNNNAN
TNCNGCNCGNNNNNNTANNCANNGNTNGGTTNANGNNCNTNNNTATNGTGCNNNNNNNGTANGNNTNNCNTNAAGAGNTT
CCNGNNCGGNNNNAGCANATNCGGATNNNAGANNNNNTGNANNCNCNANCNTNNNNANNNNNNCNTGNNNANTNNNCNNA
ANNNNNNNNNNNNNNNNNNNNNNNNNNCCCTNNNNNTNNNNCGNCNNNGNNNGNNNGNTNTGCGGCTGTTANNAAGNCNN
NCTCNATNNATAAGGGCAAGTGTNATCNNNNCNTTATTATTANNCATGCACGNNCGANNNNNGNNCNGNCNNANNNNNTN
TGNNNNNNANNATNGTGAAGCNNNNNATNNNNGNNNNTNGNNANCNTTNCNGNNCGTNNNCAANNNTNNANNNGANACCT
NNNNNNNNNCANNNANTGACTNNCANNNNTNANGTNNTATTTTTCTNNNGNNACNTNTCAANANGCNNCNNNTGACTNNC
AANTCNNNNCNNANCNNCATNNGANNNANNNNGNANNNNNNNNTNNNNAAANCCNCAACNTGNNNNGNNNNNNNNNCNNT
NNNGNNNTNNNNNNN
10/11- Results from DNA sequencing were returned. The machine could not read the majority of base pairs.
10/7-Concentrations of samples were determined after pLIC forward and reverse primers were added. (include concentrations here)
10/4- Miniprep was done using all the samples that produced pellets. (Tubes 2,5,6,7)
Please include pictures of gel images, virtual results, plates, etc, and include analysis too, rather than just listing what you did. -UM
weeks 9 & 10
10/31- samples were spun down and stored in the 4 degrees fridge. Only 4 out of the 8 samples produced a pellet. (Forgot to take pics of tubes, sorry)
10/30-The first two plates had grown many colonies. (in less than 48 hrs.) Plates were moved to 4 degrees fridge after creating a master plate.
10/29-The steps from the previous day were repeated just in case the first round failed to clone.(It was noted that the following day (wed, Oct 30) the second set was missing from the incubator and the first two plates showed no signs of growth.
10/28- Cohesive end generation along with annealing were carried out using cut pNIC-BSA4 plasmid with a concentration of approximately 74.7 ng/uL. The samples were then added to agar plates containing sucrose and kanamycin and stored in the 37 degrees celsius refrigerator.
10/24- Virtual screening and set up of active sites was started. Ligands will be found next. Crystal structure is available in PDB and thus a homology model will not need to be created.
10/23- Today Preparation of PNIC-Bsa4 as an accepting vector was retried.
weeks 7&8
10/17- Cloning of pNIC-Bsa4 was began. After preparation of pNIC-Bsa4 was done, an error was made in that the QF buffer used during PCR cleanup was lacking its normal qualities. This was determined after Nanodrop was carried out and thus this protocol will be continued again.
10/14-10/15:Transformation of pNIC-BSa4 was attempted again after the first yield was considered too small (14.0 and 12.8 ng/uL). This time the yields after midi-Prep were 45.9 and 45.6 ng/uL.
10/11- Another flask containing LB media was created again and stored in the fridge.
Midi-prep- 10/8 The first attempt of midi-prep was performed leading up to a concentration of 14 ng/ul and 12 ng/ul. These yields were determined to be too low and transformation will be regrown and attempted again.
Transformation- 10/7-8 Bacteria DH5 alpha was grown with the pNIC-Bsa4 Restriction enzyme.
Image of your secondary PCR from 92613? Need figure captions as well. - Michael T.
weeks 5&6
Protein Characterization: 10/3-10/4 pNIC-BSA 4 was grown with DH5-alpha. The first attempt had a yield that was considered overgrown. This will be attempted again.
PCRSQUARED: 10/1/13 This was done using the custom tails. Some contamination could be seen. Next will be PCR cleanup which will be done the following week.
Pymol Refreshner: 9/27-9/28
Analysis: The data tells us where the different important molecule chains are. The proteins analyzed include 3HBB, 1U72, 3CL9, and 2H2Q. Cofactors were identified and labeled. However, the most important aspect of this lab was aligning the 3CL9 and 1U72 proteins to see how and if they bind when aligned. Molecules are able to be studied virtually before being worked with in virtual lab to save potential time and money by previewing how different substrates bind to different active sites of molecules. No difficulties were experienced while working with Pymol. However, some possible sources of error include: not following directions, uploading wrong proteins, or forgetting to identify an important chain.
Secondary PCR: 9/26/13 was redone using the custom tails.
*computer program did not let me crop out black areas. Fig. 2. This gel image shows the custom tail primers that were ordered in 1x agarose gel. The number of nucleotides in this image is approximately 1000 b.p. in lenght.
Week 3 & 4:
Will - Good work in lab. show your final tail Primer sequences. Include an Analysis after each experiment. Show a ladder image. - Dr. B 092713
LB Broth: 9/19/13 A flask of LB was started and is still being created. It is being held in the -20 degrees C fridge. 16 Agar plates with kanamycin were created by Dax and Julia (group members).
Primary and Secondary PCR: 9/16/13
Secondary PCR might be redone since option A was used instead of the newly ordered custom primerers.
Tail Primer Design 9/13/13
This was the primers created for future cloning. Here is the sequence:
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGACGCGCTGACCACCCTCCCGATCAAAAAGCACACCGCGCTGCTGAACCGTTTCCCGGAAACCCGCTTCGTTACCCAACTGGCGAAAAAGCGTGCGTCTTGGATCGTTTTCGGTCACTACCTCACTCCAGCACAGTTTGAAGATATGGATTTTTTCACCAATCGTTTCAATGCGATCCTGGACATGTGGAAAGTTGGCCGTTACGAAGTTGCGCTGATGGACGGTGAACTGACCTCTGAACACGAAACCATCCTGAAAGCGCTGGAACTCGACTACGCTCGCATCCAGGACGTTCCAGACCTCACCAAACCGGGCCTGATCGTTCTCGACATGGACTCTACCGCTATCCAGATCGAATGCATCGACGAAATTGCGAAGCTGGCGGGTGTTGGCGAGGAAGTGGCCGAAGTTACGGAACGTGCGATGCAGGGCGAGCTGGACTTCGAACAGTCTCTGCGTCTGCGTGTTTCTAAACTCAAAGACGCCCCTGAACAGATCCTGAGCCAGGTTCGTGAAACGCTGCCGCTCATGCCTGAACTGCCGGAACTGGTTGCGACCCTGCACGCGTTCGGTTGGAAGGTAGCAATCGCGTCTGGTGGTTTCACCTACTTTTCTGACTACCTGAAGGAACAACTCAGCCTCGATTACGCGCAGTCTAACACCCTGGAAATTGTTTCTGGTAAACTGACTGGTCAAGTTCTGGGTGAAGTTGTGTCTGCTCAGACCAAAGCGGACATCCTGCTGACCCTGGCGCAACAGTACGACGTTGAAATCCACAACACCGTTGCGGTGGGTGACGGTGCGAACGACCTGGTTATGATGGCGGCTGCGGGCCTCGGTGTAGCGTACCATGCGAAACCGAAGGTTGAGGCGAAGGCGCAGACCGCAGTTCGTTTCGCTGGTCTCGGTGGTGTCGTTTGCATCCTGTCTGCGGCGCTCGTTGCGCAGCAAAAACTCTCTTGGAAATCTAAACCGTAACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG
TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAA
TAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT
Restriction Enzyme Digest 9/10/13
Analysis: The three pieces of cut plasmids showed extensive and defined bands. This gel was also being run with PCR and that is why there is a 2nd ladder in lane 6. Lane 3 showed the first cut at about 1500 bp and 2nd at about 800 b. Lane 4 had 2 cuts at about 600 bp and 200 bp. Lane 5 had 2 distinct bands at 600 base pairs and 200 bp. Some possible sources of error that could have happened would be incorrect calculations and/or measurements. Some other sources of possible errors include pierced gel or incorrect pipetting The bands appeared as expected. The temp. recommended is 80 degrees celsius.
PCR Attempt 3:
PCR Attempt 2: still no bands! (did not take a picture/wasn't sure if we had to).
Week 1 & 2
Will - good. on your next gel image, crop out the black stuff. Can crop directly from gel software. Dr. B 090913
9/2/13-PCR
9/2/13-Oligotide Primer Design
The sequence used was found on NCBI and it varied from the one off of the wikispaces page. This protein was designed for use on vibrio cholerae. The exact strain is ICE224.
antacgncntanacancanatttanttaagtatnnaanancangagttaatgtaananca ncaaggatagatanancanatagaaggtantgtgganancanatatantagganaaagga aaataanancanagggcaaaanan.
This is the modified oligotide sequence:
1 ATGGACGCGCTGACTACCCTGCCGATCAAAAAGCACACTGCGCTG 45 2 GCCAGTTGGGTAACGAAGCGGGTTTCTGGGAAACGGTTCAGCAGCGCAGTGTGCTTTTTG 60 3 GCTTCGTTACCCAACTGGCGAAAAAACGTGCGAGCTGGATCGTATTTGGCCACTACCTCA 60 4 CGATTAGTGAAGAAGTCCATATCTTCGAACTGAGCCGGGGTGAGGTAGTGGCCAAATACG 60 5 AAGATATGGACTTCTTCACTAATCGCTTCAACGCGATCCTCGATATGTGGAAGGTTGGTC 60 6 CAGAGGTCAGCTCACCGTCCATGAGCGCAACTTCGTAACGACCAACCTTCCACATATCGA 60 7 ACGGTGAGCTGACCTCTGAACACGAAACCATCCTGAAAGCCCTCGAACTCGATTATGCTC 60 8 TCAGACCAGGCTTAGTCAGATCCGGAACGTCCTGGATACGAGCATAATCGAGTTCGAGGG 60 9 ATCTGACTAAGCCTGGTCTGATCGTTCTGGACATGGATTCTACCGCTATCCAGATCGAAT 60 10 CCTCACCTACACCCGCGAGCTTCGCGATTTCGTCGATGCATTCGATCTGGATAGCGGTAG 60 11 CGCGGGTGTAGGTGAGGAGGTTGCGGAAGTTACCGAACGTGCCATGCAAGGTGAACTGGA 60 12 CCTTGAGTTTAGAAACACGCAGGCGCAGAGACTGCTCGAAATCCAGTTCACCTTGCATGG 60 13 TGCGTGTTTCTAAACTCAAGGACGCCCCTGAACAGATCCTCAGCCAAGTCCGTGAAACTC 60 14 CAGCGTTGCCACCAGCTCCGGGAGTTCCGGCATCAGCGGCAGAGTTTCACGGACTTGGCT 60 15 GCTGGTGGCAACGCTGCACGCCTTTGGTTGGAAAGTTGCCATCGCAAGCGGTGGTTTTAC 60 16 AATCCAGAGAGAGCTGTTCCTTCAGGTAATCAGAAAAGTAGGTAAAACCACCGCTTGCGA 60 17 AGGAACAGCTCTCTCTGGATTACGCGCAGTCTAACACTCTGGAGATCGTTTCCGGTAAAC 60 18 TCTGGGCAGAAACAACCTCGCCCAGGACTTGACCAGTCAGTTTACCGGAAACGATCTCCA 60 19 GAGGTTGTTTCTGCCCAGACCAAAGCGGATATTCTGCTGACCCTGGCGCAGCAATACGAC 60 20 CGTTCGCACCATCACCAACCGCAACGGTATTGTGGATCTCAACGTCGTATTGCTGCGCCA 60 21 TTGGTGATGGTGCGAACGACCTGGTTATGATGGCGGCAGCCGGTCTCGGTGTCGCGTACC 60 22 CGAACCGCCGTTTGCGCTTTCGCTTCCACTTTCGGTTTCGCATGGTACGCGACACCGAGA 60 23 CGCAAACGGCGGTTCGTTTCGCTGGCCTGGGTGGCGTAGTTTGCATCCTGTCTGCGGCGC 60 24 CGGTTTAGATTTCCAAGACAGCTTTTGCTGAGCAACCAGCGCCGCAGACAGGA 53
Analysis: A reverse primer was created to help synthesize PCR. This was done using DNA works on the NBCI website. After this, the primer was placed for ordering on the google docs VDS page. Some possible sources of error include inputing the wrong DNA sequence when creating the primer or inputing incorrect info into the ordering page.
Week 1: 8/30/13-Target Selection sent by email
The protein to be studied for targeted is phoshposerine phosphatase.
Gene id:
YP_005334106.1
8/30/13- Nanodrop Spectrophotometer: Determining the Concentration of DNA Plasmid
The purpose of this lab was to be able to use a spectrometer to identify the absorption and concentration of pGBR-22. Although practice, this laboratory technique will probably be used in individual research.
Images:
Sample 1: Elution graph showing pGBR-22 (205.4ng/uL) with a concentration of 198.1ng/uL.
Sample 2: Elution graph showing pGBR-22(205.4ng/uL) concentration of 195.3ng/uL.
Results and Conclusions: This experiment gave additional practice with using the photo spectrometer. Both samples had a theoretical concentration of 205.4ng/uL. However, sample 1 had a concentration of 198.1ng/uL while sample 2 had a concentration of 195.3ng/uL. Some possible errors and explanations for these discrepancies could have been that residue from the buffer or water were left on the lens. There could have also been some unrelated particles inside the tubes containing the samples.
8/29/13-Submission of DNA to Sequencing Machines
Purpose: To prep a plasmid for DNA sequencing at an offsite facility.
Images: